Thbs3a
Repression of thbs3a expression by cxcr4a reduced the occurrence of the boundary defect. We demonstrated that cxcr4a is an upstream regulator of thbs3a and that defective boundary cells could not process epithelialization in the absence of intracellular accumulation of the phosphorylated focal adhesion … See more MicroRNAs (miRNAs) are short (approx. 22 nt) endogenous non-coding RNAs that regulate gene expression at the post-transcriptional level … See more WebMO1-thbs3a Previous Names None Target. thbs3a ; Sequence 5' - AGTAAAAGGCGAAAGATTTGTGCGT - 3' Select Tool ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT. Disclaimer Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent. Note None …
Thbs3a
Did you know?
WebLegend. Settings. Analysis WebAlthough microRNA-206 (miR-206) is known to regulate proliferation and differentiation of muscle fibroblasts, the role of miR-206 in early-stage somite development is still unknown. During somitogenesis of zebrafish embryos, reticulon4a (rtn4a) is specifically repressed by miR-206. Somite boundary was defective, and actin filaments were crossing over …
WebPHENOTYPE Phenotype in AB + MO1-thbs3a + MO2-cxcr4a. Phenotype Conditions Figures somite border morphology, ameliorated: standard conditions: Fig. 5 from Lin et al., 2024: … WebPhenotype: whole organism thbs3a expression increased amount, abnormal: Note: This phenotype statement describes a gene expression or antibody labeling pattern. Anatomy …
WebReactome is pathway database which provides intuitive bioinformatics tools for the visualisation, interpretation and analysis of pathway knowledge. Reactome THBS3 [extracellular region] Toggle navigation About What is Reactome ? News Team Scientific Advisory Board Editorial Calendar Statistics Our Logo License Agreement Privacy Notice … Web1 Jul 2024 · microRNA-206 modulates an Rtn4a/Cxcr4a/Thbs3a axis in newly forming somites to maintain and stabilize the somite boundary formation of zebrafish embryos. ...
WebThis activity largely decreases thbs3a expression in the epi-thelial cells of the somite boundary, which causes epithelialization of boundary cells through …
diy darth helmet space ballsWebthbs3a thrombospondin 3a [ (spotted gar)] Gene ID: 102689959, updated on 11-Apr-2024. Summary Other designations. thrombospondin-3-like. Gene provides a unified query environment for genes defined by sequence and/or in NCBI's Map Viewer. thbs3a thrombospondin 3a [ (spotted gar)] Gene ID: 102689959, updated on ... craigslist cars 1955 chevyWebFigure 7. Change of the expression levels of miR-206, Rtn4al, Cxcr4a and Thbs3a resulted in the failure of p-FAK to concentrate at the intersomitic boundary of defective boundary … craigslist cars 500 to 1000Web2 Nov 2024 · Understanding the emerging roles of non-coding RNAs (ncRNAs) in the regulation of the physiology of aquaculture animals raises the possibility of potential applications of ncRNAs for the advancement of aquaculture. Long non-coding RNA (lncRNA), like other ncRNAs do not encode proteins. However, by interacting directly with … diy darlington transistorWebRepression of thbs3a expression by cxcr4a reduced the occurrence of the boundary defect. We demonstrated that cxcr4a is an upstream regulator of thbs3a and that defective boundary cells could not process epithelialization in the absence of intracellular accumulation of the phosphorylated focal adhesion kinase (p-FAK) in boundary cells. craigslist cars and truck san fernando valleyWebView THBS3 mouse/human homology from Alliance Direct with: genes, location, sequences, associated human diseases craigslist cars and trucks azWebthbs3a [extracellular region] Stable Identifier. R-DRE-66522. Type. Protein [EntityWithAccessionedSequence] Species. Danio rerio. Compartment. extracellular … diy david and goliath costume